Animals

Female Sprague Dawley (SD) rats (age, 8~10 weeks; weight, 180~200 g) and C57BL/6 mice (half male and female; age, 8~10 weeks; weight, 15~20 g) were purchased from the Guangdong Medical Laboratory Animal Center and housed under standard specific pathogen free (SPF) condition. All animals were bred in the specific pathogen free (SPF) animal house under a standard regulated environment (12-h light/dark cycle) with free access to food and water, and allowed to acclimate for at least seven days before the experiments. The animals were randomly allocated for different experimental groups and no blinding method was used during the experimental procedure. All animal experimental procedures using laboratory animals were conducted in accordance with the Guide for the Care and Use of Laboratory Animals (National Research Council, 1996) and approved by the Animal Care and Use Committee of Sun Yat-sen University (SYSU-IACUC-2021-000438).

NSCs culture and differentiation

NSCs were obtained from the fetal brain of embryonic 14-day SD rats. Briefly, the cerebrum of embryos was dissected out and the covering pia mater and blood vessels were removed under a microscope. Then the brain was mechanically dissociated in pre-cooling phosphate-buffered saline (PBS) to generate a single-cell suspension and centrifuged at 1000 revolutions per minute (rpm) for 10 min. The cell pellet was resuspended and cultured with DMEM/F-12 medium (Gibco, Life Technologies, USA) supplemented with 2% B-27™ supplement (50X; Gibco, Life Technologies, USA), 20 ng/ml growth factor (EGF; Peprotech, New Jersey, USA), 20 ng/ml fibroblast growth factor (FGF; Peprotech, New Jersey, USA), and 1% penicillin/streptomycin (10,000 U/ml, Gibco, Life Technologies, USA). NSCs were purified by passaged every three days, and cells between passages 2~5 were selected to perform further investigation. All cells were tested for mycoplasma contamination every 3 months.

For NSCs differentiation, the cells pellets were digested into single cells with Accutase (Millipore, Bedford, MA), and subjected to neuronal differentiation on 0.1% poly-L-lysine (Gibco, USA) coated culture dishes in Neurobasal (Gibco, Life Technologies, USA) supplemented with 2% B-27™. The medium was changed every 2~3 days.

Astrocytes culture and induction

Astrocytes were isolated from postnatal two-day SD rats. After stripping the meninges and blood vessels, cortices were mechanically then enzymatically dissociated into single-cell suspension with 0.25% trypsin at 37 °C for 15 min, followed by filtration and centrifugation to collect cell pellets. Cells were suspended with basal medium (DMEM/F-12; 10% fetal bovine serum, FBS) and plated on uncoated plates for 30 min to remove fibroblasts and endothelial cells. Subsequently, the non-adherent astrocytes were transferred into new dishes pre-coated with 0.1% poly-l-lysine. The cell medium was changed every three days and passaged when the cell fusion rate reached ~90%. Astrocytes were shaken at 200 rpm overnight to remove upper layer microglia that were attached to the surface of astrocytes, followed by administrated with PLX5622, a specific microglia scavenger, to further purify astrocytes before passage. All cells were tested for mycoplasma contamination every 3 months. To induce reactive astrocytes, cells were incubated with the triple factors TNFα (30 ng/ml), IL-1α (3 ng/ml) and C1q (400 ng/ml) for 24 h and the successful induction of reactive astrocytes was verified by highly increased C3⁺ astrocytes formation via immunofluorescent staining and flow cytometry assay.

Lentivirus-mediated overexpression of UCHL1

The lentivirus overexpressing UCHL1 (OE-UCHL1-LV) and empty lentiviral vector (NC-LV) were constructed by HanBio Technology (Shanghai, China). Lentivirus designed to overexpress UCHL1 were cloned into the pHBLV-CMV-MCS-3FLAG-EF1-GFP-T2A-PURO lentiviral vector containing the ZsGreen reporter gene. The lentivirus vectors were transferred into 293 T cells in the presence of packaging plasmids (psPAX2 and pMD2G) using LipofiterTM (HanBio Technology) for lentivirus packaging. 293 T cells were transfected and the overexpression efficacy were assessed after 48 h by qPCR. The final lentiviral vector titer was 2 × 10⁸ TU/ml.

For NSCs infection, cells were transfected with diluted lentiviral solution with a multiplicity of infection (MOI) of 25, with supplement of 1 mg/ml polybrene. At 24 h after transfection, the medium was replaced with fresh basal medium (FBS-free) without penicillin/streptomycin for further 24 h. GFP expression was visualized under fluorescent microscope at 48 h post-transfection, and overexpression of UCHL1 was determined by Western blot and qPCR analysis.

Co-culture of NSCs and astrocytes

Two in vitro co-culture systems were conducted here (Fig. 4C): (1) We used a transwell system that allowed interaction via diffusible factors. Unstimulated Control astrocytes or Reactive astrocytes in the transwell were on the top of NSCs cultured in the lower chamber, and both cells were cultured within the basal culture medium (free of FBS) of NSCs. (2) a simple astrocytes conditional medium (ACM) transfer from the Control/Reactive astrocytes cultures to NSCs’ cultures. After incubation in the normal or inducing medium, astrocytes were cultured with the basal culture medium (free of FBS) of NSCs for another 24 h, then the ACM from the Control astrocytes or Reactive astrocytes were collected and added into the basal medium of NSCs at a ratio of 1:1 ACM to NSCs culture medium. The cell proliferation, aggresome formation and proteasome activity was assessed at 24 h later.

Cell proliferation assay

Cell proliferation in vitro was examined by EdU incorporation. NSCs were incubated with a culture medium supplemented with 10 µM EdU overnight before harvesting. Cells were fixed with 4% paraformaldehyde (PFA) followed by permeabilization, then washed twice with 3% bovine serum albumin (BSA) and stained using Click-iT EdU assay kit (US Everbright INC.) in accordance to the manufacturer’s instructions. After washed once, the cells were resuspended with Hoechst solution (2 µg/ml; US EVERBRIGHT INC.) for DNA counterstaining prior to analysis on Cytoflex LX or laser scanning confocal microscope (LSCM). The control cells that were not subjected to EdU but underwent fluorescent EdU detection were used as a negative base to assess cutoff values for EdU positivity. For quantification of EdU assay, the ratio of the EdU⁺ cells in at least three replicates among different groups were counted.

Proteostat analysis

Cells were fixed as mentioned above, then permeabilized with 0.5% Triton X-100/PBS on ice and gently shake for 30 min. After washed twice with PBS, cells were resuspended with PROTEOSTAT Aggresome Detection Reagent (1:2000) and protected from light at room temperature (RT) for 30 min, and subsequently counterstained with Hoechst 33342 (1:1000). The stained cells were analyzed using confocal microscope. For flow cytometry, 500 µl of freshly diluted 1:10000 PROTEOSTAT Aggresome Detection Reagent was applied to incubate cells for 30 min under protection from light. A nutrient deprivation assay that cleared proteostat and a proteasome inhibitor were conducted as controls. MG132, a proteasome inhibitor accelerating the formation of perinuclear aggresome within cells, was used as a positive control. For nutrient deprivation, cells were incubated in HBSS (Gibco) supplemented with 1 mM HEPES that prevented over-acidification for 3 h, then the medium was replaced with basal culture medium. Proteostat labeling was determined by the relative fluorescence area of protein aggresome in the same field of view across different treatments, with at least three biological replicates.

Proteasome activity assay

Proteasome activity assays were performed by a proteasome activity probe according to the instructions. The treated cells were incubated with the 5 µM proteasome activity probe Me4BodipyFl-Ahx3Leu3VS (Boston Biochem) for 2 h at 37 °C, then washed and analyzed via flow cytometry.

Enzyme-linked immunosorbent assay (ELISA)

The C3a level in the peripheral blood and CSF collected from SCI rats were detected through RayBio huMan C3a ELISA kit (RayBiotech) following the manufacturer’s instructions. Briefly, 100 µl standard or sample was added to each well and incubated 2.5 h at RT with gentle shaking, then washed four times and incubated with biotinylated antibody for 1 h. 100 µl HRP-conjugated Streptavidin was subsequently added, followed by incubation of 3,3,5,5′-tetramethylbenzidine (TMB) one-step substrate reagent for 30 min at RT in the dark with gentle shaking. Finally, terminating the action with stop solution and the absorbance value at 450 nm was measured and recorded immediately.

Spinal cord injury model and lentivirus administration

To produce rat model of the 10th thoracic vertebra (T10) complete transection SCI, female SD rats were anesthetized and the back fur was shaved and disinfected with Iodine Volts Swab. An approximately 2 cm incision was made on the T9-T11 skin, then the fat, fascia layer and paravertebral muscles were separated successively to expose the T10 vertebra. Then T10 laminectomy was performed and T10 spinal tissue was transected completely using a sharp scalpel. After hemostasis, rats were randomly divided into six groups, and a total of 10 μl specific mixture was injected into the lesion site using a micro syringe according to the animal groups as follows: Sham group (no SCI; n = 12); lesion control group (PBS; n = 12); empty lentiviral vector (NC-LV; 2 × 10⁸ TU/ml; n = 12); lentiviral vector encoding UCHL1 (OE-UCHL1-LV; 2 × 10⁸ TU/ml; n = 12) group; recombinant human UCHL1 (rh-UCHL1; 4 μm; n = 12) group; and the LDN-57444 (UCHL1 inhibitor; 2 mM; n = 12) group. A total of 5 μl virus or recombinant protein was separately mixed with 5 μl Matrigel before injected into the lesions of SCI rats to avoid loss.

The body temperature of animals was maintained at ~37 °C using a heating pad during the entire surgery until revival fully from anesthesia. During postoperative care, animals underwent manual bladder evacuations till autonomous urination restoration, and checks daily for wounds, infection, weight loss, autophagy of toes and mobility. All animals used in this experiment did not show wound infection, erosion or self-induced wounds.

Adeno-associated virus (AAV) construction and injection

The AAV targeting UCHL1 pAAV-Nestin-tdTomato-P2A-3xFLAG-Uchl1-tWPA or the control vector only with tdTomato fluorescence (pAAV-Nestin-tdTomato-P2A-3xFLAG-MCS-tWPA) were generated by OBiO Technology Corp., Ltd (Shanghai). UCHL1 gene was sub-cloned into pAAV-Nestin-tdTomato-P2A-3xFLAG-WPRE plasmids to produce pAAV-Nestin-tdTomato-P2A-3xFLAG-Uchl1-tWPA. The virus titer was 6.81E + 12 Vector Genomes per mL (VG/ml) determined by qPCR. Female SD rats underwent the T10 complete transection SCI as described above, then the virus (1.5 μl in volume) was delivered into the lesion center with a microsyringe immediately post-surgery. Animals were sacrificed at two weeks after virus injection for further analysis.

BrdU assay

The activation of NSCs in the spinal cord was evaluated by BrdU (5-bromodeoxy-2′-deoxyuridine; Sigma) after AAV injection. SCI rats administrated with AAV were intraperitoneally injected with BrdU (30 mg/kg body weight) daily after surgery for 2 weeks until euthanasia. The injured spinal cords were collected and frozen sections (10 µm) were prepared on a cryostat. Sections were pretreated with 2 M HCL for 30 min at 37 °C, followed by 0.1 M boric acid (pH 8.5) (Biosharp) for 10 min at room temperature. Then sections were blocked, incubated with the anti-BrdU and anti-Nestin primary antibody (1:1000; Sigma) overnight at 4 °C and Alexa Flour 488/647-conjugated secondary antibodies subsequently, and counterstained with DAPI before observation.

Blockade of reactive astrocytes and C3/C3aR pathway in SCI mice

To block reactive astrocytes after SCI using neutralizing antibodies [30], C57BL/6 mice rather than SD rats were selected to conduct T10 transection experiment due to the great demand of neutralizing antibodies in vivo. Expect for the Sham group (without SCI; n = 12), all mice were underwent complete T10 transection SCI and injected with triple neutralizing antibodies (Neutralizing Abs group; TNFα/IL-1α/C1q, 10 mg/kg each; n = 12), the control IgG antibody (IgG group; 10 mg/kg; n = 12) and 0.9% normal saline (Lesion control group; n = 12) via intraperitoneal injection every two days. To block the C3/C3aR pathway, C3aR antagonist (SB290157; 10 mg/kg) or 0.9% normal saline were intraperitoneally injected in SCI or Sham mice daily. And animals were treated with EdU (50 mg/kg) to track the proliferated NSCs. At 7 days post-lesion, all animals were sacrificed to evaluate the NSC activation.

Behavior test

The Basso, Beattie & Bresnahan (BBB) locomotor rating test [36] was performed at 2 days before injury, 1~3 days and weekly post-surgery to evaluate the motor functions of hind limbs. Rats were placed on a quiet and open plan to ensure spontaneous movement, then the walking and physical activities of hind limbs were observed and recorded. BBB scale comprises three parts: I. the joints movement of hind limbs, which scored 0~7; II. the gait and coordination function of the hind limbs, which scored 8~13; III. the fineness of the paw in motion, which scored 14~21. Behavior evaluation was conducted weekly post-SCI by two investigators familiar with the BBB criteria, separately.

Electrophysiology examination

Electrophysiological evaluation was carried out as previously described [37, 60] at 8 weeks after SCI in rats or 6 weeks post-injury in mice. Animals were re-anesthetized and laminectomy was performed to expose the T7 and T13 spinal cord, which are both three segments rostral and caudal to the lesion site. A bipolar stimulating electrode spacing 2 mm was positioned at the intraspinal rostral T7 segment, and a silver ball electrode placed at the caudal T13 segment to record evoked response. 0.1 ms square wave pulse was delivered at 10 ms interval and field activity was amplified and recorded. At least 20 trails from each recording site were averaged and the amplitude of evoked potential was quantified.

Protein array of cerebrospinal fluid from SCI animals

Cerebrospinal fluid (CSF) was extracted using paracentesis from the cerebellomedullary cistern. Briefly, at 6 h after T10 complete transection SCI, rats (n = 4) were re-anesthetized and fixed with a stereotaxic apparatus. Then the occipital protuberance was exposed, and a glass capillary was inserted into the cerebellomedullary cistern carefully through the occipital bone. Approximately 100~120 μl CSF was collected from each rat and kept at −80 °C for further investigation. CSF samples from an equal number of rats (n = 4) without surgery were used as the control.

Protein microarray analyses of CSF harvested from the normal/SCI rats were performed by G-Series Rat Cytokine Array (RayBiotech, Inc., Guangzhou, China) accordingly to the manufacturers’ instructions. A total of 100 μl sample from each rat was used and raw data obtained was conducted background subtraction and normalization before clustering analysis. Gene ontology (GO) annotation, consisting of three parts including molecular function, biological process, and cellular component, was applied to identify functions of potential genes. Possible signaling pathways involved were analyzed by the Kyoto Encyclopedia of Genes and Genomes (KEGG) database.

Immunofluorescent staining

For immunocytochemistry analysis, the cells were fixed with 4% PFA and permeabilized using 0.5% Triton X-100, then blocked in 5% BSA for 1 hour at RT. For immunohistochemistry, the animals were perfused with 0.9% normal saline followed by 4% PFA in 0.1 M PBS (pH 7.2), then 2~3 cm spinal segment encompassing the lesion center, with 2 segments above (+4 mm) and 2 below (−4 mm), was dissected and extracted. The samples were post-fixed for 6~8 hours and dehydrated in 20% and 30% sucrose for 3 days successively. After embedded in Tissue-Tek O.C.T. (Sakura), the longitudinal slices (10 μm) encompassing the lesion center and the transverse sections (10 μm) of the T10 lesion epicenter were collected on a cryostat and stored at -20°C for further use. The frozen sections of the spinal cord were washed in PBS for 15 mins, and subsequently underwent antigen retrieval using Proteinase K and blocking with 5% BSA supplemented with 0.3% Triton X-100 for 2 hours. After the blocking procedure, the fixed cells and slices were incubated with the first antibodies overnight at 4 °C. The first antibodies used in the present study included: UCHL1 (1:300; Cell Signaling Technology, CST), Nestin (1:300; Cell Signaling Technology, CST), SOX2 (1:300; Abcam), Glial Fibrillary Acidic Protein (GFAP; 1:300; Cell Signaling Technology, CST), Microtubule Associated Protein 2 (MAP2; 1:300; Abcam), Neurofilament 200 (NF-200; 1:300; Cell Signaling Technology, CST), CNPase (1:300; Cell Signaling Technology, CST), NeuN (1:300; Abcam), C3a (1:10; Abcam), C3aR (1:200; Santa Cruz), NG2 (1:200; Santa Cruz), Doublecortin (DCX; 1:300; Abcam), Ki-67 (1:800; Abcam), Tubulin β3 (1:300; Cell Signaling Technology, CST), BrdU (1:1000, Sigma). Post-washing in PBS three times, cells and sections were subsequently incubated with Alexa Flour 488/594/647-conjugated secondary antibodies and counterstained with DAPI (1:5000; Sigma). All immunofluorescence images were acquired using a Zeiss LSM 880 confocal microscope.

Quantification of confocal analysis

All confocal images from cells and spinal tissues were examined using a Zeiss LSM 880 confocal microscope and quantified in a blinded manner as follows. 4~5 spinal cord sections from different levels (including the dorsal, the middle, and the ventral) were selected in each rat/mouse. The sections used for quantification were selected from the same level among groups as much as possible under different conditions. The images for quantification were mainly captured from the lesion site in the longitudinal sections and surrounding the central canal in the transverse sections of SCI animals. The diagrams that illustrate where micrographs are imaged from and the quantitative sites in related figures were shown in Fig. 6A. Each data point represents once repeated experiment or acquired from one rat/mouse. All experiments were conducted at least three times with biological replicates.

To quantify UCHL1-positive cells in the lesion site of the spinal cord, the percentage of DAPI signals surrounded by UCHL1 was counted. To quantify the C3⁺ reactive astrocytes, SOX2⁺ NSCs, proliferated NSCs, and neurons in vitro and in vivo, C3/GFAP⁺, Ki-67/Nestin⁺, SOX2/Nestin⁺, BrdU/Nestin⁺, BrdU/Tubulin β3⁺ double-staining cells were counted manually in the same field of view and the ratio of positive cells were quantified. To quantify the GFP⁺ cells infected by lentiviral vector encoding UCHL1 in the lesion center in vivo, double-staining of GFP/Nestin⁺ NSCs, GFP/NG2⁺ OPCs, GFP/Tubulin β3⁺ neurons, GFP/NeuN⁺ neurons, and GFP/GFAP⁺ astrocytes was manually counted, and the ratio of individual cell to that of the total GFP⁺ cells was calculated, respectively. To quantify the immunoreactivity of Nestin and NF-200, the relative fluorescent area of Nestin/NF-200 in the lesion center of the individual optical section was measured using Image J.

Quantitative real-time polymerase chain reaction (qPCR)

Total RNA from NSCs or spinal cord tissues was extracted using Trizol (Invitrogen, life technologies) according to the reagent specification. The quantality of RNA yield was determined by the Nanodrop one (ThermoFisher). Total RNA was subjected to reverse transcription into cDNA using the PrimeScript RT reagent Kit (Vazyme). Q-PCR assay was conducted using the SYBR Premix EX Taq (Vazyme). The expression levels were normalized to those of glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Relative expression of genes was calculated as fold changes using the 2−ΔΔCt method. The primer sequences for genes are as follows. Uchl1, Forward primer (5′–3′): TGAAGCAGACCATCGGGAAC, Reverse primer (5′–3′): GAGTCATGGGCTGCCTGAAT; Uchl3, Forward primer (5′–3′): GGTCAGACTGAGGCACCAAG, Reverse primer (5′–3′): CTCATCAGGGTCGCGCTC; Uchl5, Forward primer (5′–3′): AGACCTTAGCAGAACACCAGC, Reverse primer (5′–3′): CAGCAGTGTACACATGTCCAAAT; Gapdh, Forward primer (5′–3′): TGATTCTACCCACGGCAAGTT, Reverse primer (5′–3′): TGATGGGTTTCCCATTGATGA.

Western blotting

Western blot was conducted to detect protein enrichment in cells and spinal tissues. In brief, cells and about 1 cm spinal tissues containing the lesion site were lysed in PIPA (Solarbio) supplemented with PMSF (1:100; Solarbio) and ultrasonic splitting on ice. A total of 20 µg protein was run on 10-12% sodium dodecyl sulfate-polyacrylamide electrophoresis (SDS-PAGE) gel, transferred to polyvinylidene difluoride (PVDF; Millipore, Mississauga, Canada) membranes and blocked with 5% no-fat milk. Then membranes were incubated with first antibodies overnight at 4 °C with gentle shaking, followed by a combination with horseradish peroxidase (HRP)-conjugated secondary antibodies (1:1000). Protein enrichment was visualized via chemiluminescence reagent and the grayscale analysis of bands was determined using Image J. First antibodies applied in this study are as follows: UCHL1 (1:1000; Cell Signaling Technology, CST), proteasome 20S (1:1000; Affinity Biosciences LTD), Ubiquitin (1:1000; Abcam), Nestin (1:1000; Cell Signaling Technology, CST), GFAP (1:1000; Cell Signaling Technology, CST), MAP2 (1:1000; Abcam), NF-200 (1:1000; Cell Signaling Technology, CST), C3a (1:1000; Abcam), C3aR (1:500; Santa Cruz), DYKDDDDK Tag (1:1000; Cell Signaling Technology, CST), GAPDH (1:1000, Beyotime Biotechnology), β-actin (1:1000, Beyotime Biotechnology). GAPDH and β-actin were used as the internal controls.

Statistics

SPSS (Version 20.0; Abbott Laboratories, Chicago, IL) was applied for statistical analysis. Independent, Two-tailed unpaired Student’s t test was used for comparisons between the two groups. For multiple comparisons, One-way analysis of variance (ANOVA) followed by Tukey HSD post hoc analysis or Kruskal-Wallis test with Bonferroni correction analysis was selected. And two-way ANOVA with Tukey HSD was conducted for BBB scores analysis. No statistical methods were used to predetermine the sample size. Animals were randomly allocated to experimental groups. No blinding method was used during the experimental procedure. There were no animal exclusion criteria. The variance was similar between the groups that were being statistically compared. All data were presented as mean ± the standard error of the mean (SEM) and P < 0.05 was deemed statistically significant.

• SEO Powered Content & PR Distribution. Get Amplified Today.
• PlatoData.Network Vertical Generative Ai. Empower Yourself. Access Here.
• PlatoAiStream. Web3 Intelligence. Knowledge Amplified. Access Here.
• PlatoESG. Automotive / EVs, Carbon, CleanTech, Energy, Environment, Solar, Waste Management. Access Here.
• BlockOffsets. Modernizing Environmental Offset Ownership. Access Here.
• Source: https://www.nature.com/articles/s41419-023-06003-8